rs1935648 chr10:32963335 C>G
- Sequence
tgttcctctatgatcacaagaatt[C/G]cctatttagaactgcatatgggtg
- ASB in cell types
- tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| tibial nerve | 1.64 | n/a | 1.33 |
Items per page:
1 – 1 of 1