rs193779 chr16:11257108 G>A
- Sequence
aaatggtgcattctcagacgtgat[G/A]aatccccaaacctggtttcctagc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.26 | 0.75 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.02 | 0.73 | 1.90 | |||
| GM12878 (female B-cells) | 0.53 | 0.31 | 1.30 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid