rs1938935 chr11:86608282 C>G
- Sequence
gcagccaagaaatactgccgtgta[C/G]ctcttgagtccacgcacgcttgct
- ASB in cell types
- KMS-11 OCI-LY7 (diffuse large B-cell lymphoma) liver
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.08 | 1.04 | 1.28 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood