rs194742 chr14:68820766 T>C
- Sequence
ctgtcgctatggggttgcctattc[T/C]ggatacttcacctatccagagctt
- ASB in cell types
- Jurkat (T-cells)
- ASB for transcription factors
- GABPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABPA_HUMAN | n/a | 1.59 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diastolic blood pressure (dbp), fasting insulin, homa-b, homa-ir, microalbuminuria, mitral annular calcium, obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio