rs194746 chr14:68816170 C>T
- Sequence
acctactttaacgccctctgactt[C/T]ccgctctttgaatatggggcaaaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells) LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.67 | 0.20 | 1.49 | |||
| GM12878 (female B-cells) | -0.21 | 1.44 | 1.33 | |||
| LNCaP C4-2B (prostate carcinoma) | -0.45 | 1.11 | 1.25 |
Items per page:
1 – 3 of 3