rs195156 chr11:61961591 C>T
- Sequence
ttatggagggagctcaaacccaag[C/T]ctcaaactctggatacaaggtaca
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | -0.42 | 1.35 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, hdl cholesterol, height, late onset alzheimers disease, maternal transmission distortion, mitral annular calcium, obesity with early age of onset (age >2), total cholesterol, transmission distortion