rs196225 chr10:119735167 A>G
- Sequence
attttctggttgttggagactctt[A/G]agggatctgctttcattcacaaaa
- ASB in cell types
- HAEC (human aortic endothelial cells) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HAEC (human aortic endothelial cells) | 1.55 | n/a | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -2.91 | 2.20 | 2.00 |
Items per page:
1 – 2 of 2