rs196405 chr1:24515636 G>T
- Sequence
atgtacccaaaatatttcccttcc[G/T]atgactttcttggagcagaacttc
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.08 | 0.78 | 1.99 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.98 | -0.16 | 1.98 |
Items per page:
1 – 2 of 2