rs196434 chr1:24536159 A>G
- Sequence
ttcaccttttccagtatcttgtta[A/G]ccactagttcttgagttttttggc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.15 | 0.54 | 1.31 | |||
| HEK293 (embryonic kidney) | -0.26 | 0.63 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Liver, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid