rs196588 chr7:36283700 A>G
- Sequence
atagaagtgcacagcatacaatac[A/G]ttcattccctccctccctcctcct
- ASB in cell types
- periferal blood macrophages monocyte-derived dendritic cells monocyte-derived macrophages
- ASB for transcription factors
- SPI1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.66 | -0.72 | 2.00 | n/a | No Hit | |||
| TF65_HUMAN | 1.78 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2