rs1977749 chr1:235368142 A>G
- Sequence
ctgctctcgaactcctgatctcag[A/G]tgatccacccgcctcggcctccca
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MNT_HUMAN HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | -0.34 | 1.61 | 2.83 | n/a | n/a | |||
| HDAC1_HUMAN | -2.59 | 2.02 | 2.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis