rs1979268 chr12:10623914 A>G
- Sequence
aaaagaagccttgcccctccttga[A/G]aaaaacagataatgtacatttata
- ASB in cell types
- CWR22 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CWR22 (prostate carcinoma) | 0.99 | -0.15 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration (geographic atrophy), bipolar disorder in alcoholics, irritible bowel syndrome, ldl cholesterol, lp-pla2 activity, obesity with early age of onset (age >2), panic disorder, schizophrenia
GTEx eQTL Heart_Left_Ventricle, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis