rs1980417 chr8:133485028 C>A
- Sequence
atctgcaatccacatggctcaaat[C/A]ccatattgagagttgcatcaatcc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ZN143_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN143_HUMAN | -1.46 | 2.14 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1