rs1983163 chr3:62131792 G>A
- Sequence
ctaatcctgtggcatgtatacccc[G/A]ctcactccccctgctgttcactct
- ASB in cell types
- 22RV1 (prostate carcinoma) GM12878 (female B-cells) GM23338 bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.34 | -0.59 | 1.00 | |||
| GM12878 (female B-cells) | -0.04 | 0.52 | 1.29 | |||
| GM23338 | 1.32 | -1.38 | 1.42 | |||
| bipolar neuron | 1.06 | -1.61 | 1.33 |
Items per page:
1 – 4 of 4