rs1984273 chr10:28394044 T>C
- Sequence
atgggaagcttgacaactgtctca[T/C]acagatggagcttgatgtgtgctt
- ASB in cell types
- H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | -2.00 | 1.78 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, obesity with early age of onset (age >2), plasma aldosterone concentration, plasma aldosterone concentration corrected by plasma renin activity, rheumatoid arthritis, years of education