rs1984354 chr21:37010023 A>G
- Sequence
ccaccgacgagagctgcccagcgc[A/G]gggaaggaacgcttcttgctcaac
- ASB in cell types
- MCF10A (breast epithelial cells) H929 (plasma cell myeloma) GM12878 (female B-cells) MCF10AT1 (breast premetastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10A (breast epithelial cells) | 2.15 | -2.39 | 1.33 | |||
| H929 (plasma cell myeloma) | 2.25 | -2.55 | 1.33 | |||
| GM12878 (female B-cells) | 0.63 | 0.43 | 1.30 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | 1.25 | -1.13 | 1.00 | |||
| HeLa S3 (cervical adenocarcinoma) | 1.32 | -0.67 | 2.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Vagina, Whole_Blood