rs198481 chr20:37652266 T>A
- Sequence
aacttgccatgggaccgagggatg[T/A]tgggagcagaagagaacggctggc
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | n/a | 1.54 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio