rs198746 chr11:61609498 A>G
- Sequence
gcaggaggttctgtcaacagcgag[A/G]gaaactcgttaactgaatgtcaat
- ASB in cell types
- HepG2 (hepatoblastoma) breast tumor tissue T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.35 | 0.65 | 1.27 | |||
| breast tumor tissue | -1.64 | 2.19 | 2.50 | |||
| T47D (invasive ductal carcinoma) | 0.80 | 0.01 | 1.46 |
Items per page:
1 – 3 of 3