rs1991403 chr17:64617173 C>T
- Sequence
tgaaaactaggttacagaagggtg[C/T]tctgcaaaagattcagaattctcc
- ASB in cell types
- CLB-Ga (neuroblastoma)
- ASB for transcription factors
- PHX2B_HUMAN HAND2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PHX2B_HUMAN | n/a | 3.34 | 2.00 | n/a | n/a | |||
| HAND2_HUMAN | -2.39 | 2.47 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, asthma, comorbid depressive syndrome and alcohol dependence, height, stabilized warfarin dose, systolic blood pressure (sbp)
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Breast_Mammary_Tissue, Colon_Sigmoid, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood