rs1992179 chr2:183488727 T>C
- Sequence
cccagtcagcaccaatttcattct[T/C]gtgtgatattgctgatgtgtatca
- ASB in cell types
- neural cell
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | -1.93 | 2.04 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, antidepressant drug treatment outcome in depression, arthritis including non-rheumatoid, diastolic blood pressure (dbp), neuroticism, parkinsons disease, spine bone mineral density (bmd)