rs1999886 chr1:152983046 T>C
- Sequence
agatttgttgaataaatgaggaaa[T/C]aaacactgtggtggggacaccgtt
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ICN12 (primary pre-B acute lymphomablastic leukemia) | 1.86 | -1.43 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, fasting insulin, homa-ir, infant head circumference, total cholesterol, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Esophagus_Mucosa, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis