rs2001192 chr15:96335208 T>C
- Sequence
ggaggaaagggaccgtcataactc[T/C]tcagaatgtctgcaggaggttgaa
- ASB in cell types
- K562 (myelogenous leukemia) GM23338
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.62 | -0.32 | 1.98 | |||
| GM23338 | -1.97 | 1.89 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hdl cholesterol, hdl cholesterol change with statins, microalbuminuria, rheumatoid arthritis, urinary albumin-to-creatinine ratio