rs2001449 chr3:183211148 G>C
- Sequence
aaaacagtcagtaggtggtaagag[G/C]gggggcgagcaggcatgtgggtgc
- ASB in cell types
- SKH1 (chronic myelogenous leukemia, BCR-ABL1 positive)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SKH1 (chronic myelogenous leukemia, BCR-ABL1 positive) | 0.05 | 1.10 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Colon_Sigmoid, Esophagus_Mucosa, Nerve_Tibial, Whole_Blood