rs2002 chr6:2990991 T>C
- Sequence
gaactgtttactttcctgtaaccg[T/C]ttatccttttaactttttgcctac
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- HDAC1_HUMAN ZEB2_HUMAN IKZF1_HUMAN SKIL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC1_HUMAN | -2.67 | 2.60 | 3.00 | n/a | n/a | |||
| ZEB2_HUMAN | n/a | 2.91 | 3.00 | n/a | n/a | |||
| IKZF1_HUMAN | n/a | 0.64 | 3.00 | n/a | No Hit | |||
| SKIL_HUMAN | n/a | 2.43 | 3.00 | n/a | n/a | |||
| ZBT8A_HUMAN | n/a | 2.25 | 3.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Whole_Blood