rs200205 chr6:5457158 C>T
- Sequence
ccggtgtctccagcacatggggtg[C/T]accctgtctcatctgcaggccatt
- ASB in cell types
- hMADS-3 (adipose-derived stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hMADS-3 (adipose-derived stem cells) | 1.20 | -0.56 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Esophagus_Mucosa, Liver, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg