rs200223635 chr4:49119013 T>A
- Sequence
ttccattccattccattccattcc[T/A]ttccactcgggttgattccattcc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.34 | 0.93 | 2.00 | |||
| LNCaP (prostate carcinoma) | n/a | 1.46 | 1.00 |
Items per page:
1 – 2 of 2