rs2007418 chr22:39316389 T>C
- Sequence
ctcagcacttgagatcagccagga[T/C]aaccagtaacaggacagcaagagg
- ASB in cell types
- PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | 1.84 | -0.81 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Pituitary, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Whole_Blood