rs201182718 chr5:42734997 C>T
- Sequence
acctggaaaatcgggtcactccca[C/T]ccgaatattgcgcttttcagaccg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NRF1_HUMAN RING2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 1.50 | -1.28 | 1.33 | n/a | No Hit | |||
| RING2_HUMAN | 2.12 | -2.17 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood