rs2013503 chr8:54191783 C>T
- Sequence
gcaggctcaccattacttcctcca[C/T]tgaagctcccagtgagggcataac
- ASB in cell types
- K562 (myelogenous leukemia) liver
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.24 | 1.02 | 2.00 | |||
| liver | 1.25 | n/a | 1.33 |
Items per page:
1 – 2 of 2