rs2024092 chr19:1124032 G>A
- Sequence
gctgagctggaacagctggaaggg[G/A]agcaggatgtcagcccgggccaga
- ASB in cell types
- adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| adrenal gland | -1.79 | 1.72 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI chronic inflammatory diseases (ankylosing spondylitis, crohns disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis) (pleiotropy), crohns disease, inflammatory bowel disease
GRASP crohns disease, hip bone mineral density (bmd), irritable bowel disorder, irritible bowel syndrome, ldl cholesterol, mitral annular calcium, premature ovarian failure, spine bone mineral density (bmd), total cholesterol, ulcerative colitis
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood