rs202634 chr22:41413619 A>G
- Sequence
gaggaggaagaggaggaggagaaa[A/G]aggaggaggagggctcagcggtct
- ASB in cell types
- HEK293 (embryonic kidney) periferal blood macrophages
- ASB for transcription factors
- SPI1_HUMAN MAZ_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.07 | 2.11 | 2.31 | 1.48 | Weak Discordant | |||
| MAZ_HUMAN | 2.29 | n/a | 2.00 | 1.32 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
