rs2026552 chr10:89731203 T>C
- Sequence
aagtcagagacaggtcatttctgg[T/C]gactacaacttcaaagaaaatagt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.23 | 1.62 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, hdl cholesterol change with statins, ldl cholesterol, obesity with early age of onset (age >2), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Thyroid