rs203147 chr6:138268125 G>A
- Sequence
ggtgctggcctgtatccatctctg[G/A]actgaggcatgtcctcttgccccc
- ASB in cell types
- liver HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 0.85 | -0.11 | 1.33 | |||
| HepG2 (hepatoblastoma) | -0.33 | 0.70 | 2.00 |
Items per page:
1 – 2 of 2