rs2031968 chr9:89603395 T>C
- Sequence
aatccacccggcccgccactgtcc[T/C]ggccagtctccaaggcttcaccca
- ASB in cell types
- LNCaP (prostate carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.02 | -0.01 | 1.29 | |||
| GM12878 (female B-cells) | 0.57 | 0.44 | 1.25 |
Items per page:
1 – 2 of 2