rs2031969 chr9:89603112 C>G
- Sequence
tgctaggagagcaagctcttcatt[C/G]ttagaatccaggaagggccgggct
- ASB in cell types
- erythroid cells epidermal keratinocytes DOHH2 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 2.74 | n/a | 2.00 | |||
| epidermal keratinocytes | 1.78 | n/a | 2.50 | |||
| DOHH2 (diffuse large B-cell lymphoma) | 1.25 | -1.13 | 1.33 |
Items per page:
1 – 3 of 3