rs2033251 chr16:71426469 G>A
- Sequence
ggctgcaggcattttcttacagga[G/A]gtagcaagcttgtctaagcagagg
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- ELF1_HUMAN ZNF24_HUMAN IKZF1_HUMAN TBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | n/a | 2.76 | 1.33 | 5.46 | Concordant | |||
| ZNF24_HUMAN | -1.85 | 1.63 | 1.33 | n/a | n/a | |||
| IKZF1_HUMAN | n/a | 1.72 | 1.33 | n/a | No Hit | |||
| TBP_HUMAN | -1.46 | 1.81 | 1.33 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP hdl cholesterol, neuroblastoma (brain cancer), obesity with early age of onset (age >2), schizophrenia, serum creatinine
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid