rs2033308 chr12:53599779 C>A
- Sequence
atctcacacaccaccagtaagtgt[C/A]agtggacagtcacatgacatattc
- ASB in cell types
- gastroesophageal sphincter K562 (myelogenous leukemia)
- ASB for transcription factors
- CTCF_HUMAN ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.48 | 0.04 | 1.33 | -2.11 | Concordant | |||
| ARI1B_HUMAN | 1.95 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP body mass index (bmi), college completion, fasting blood glucose, hdl cholesterol change with statins, ldl cholesterol, total cholesterol, years of education
GTEx eQTL Artery_Aorta, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Uterus