rs2041285 chr17:62638101 G>T
- Sequence
ggtctcgaactcctgggctcaagg[G/T]ctcctcctgccccagcctcccaag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.27 | 0.94 | 2.55 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Lung, Spleen, Testis, Thyroid