rs2046735 chr11:45543989 A>G
- Sequence
ttagggcgggaacccaagccagac[A/G]cgaggccaagtcaagctagagagt
- ASB in cell types
- H1 (embryonic stem cells)
- ASB for transcription factors
- MAX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAX_HUMAN | 1.89 | -1.78 | 1.33 | -3.31 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP eye color, maternal transmission distortion, partial epilepsy, spine bone mineral density (bmd), transmission distortion