rs2056170 chr8:38906198 C>T
- Sequence
taggctgtaaagccagtatggctg[C/T]gtgcctgcactggtgccctctctg
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | -3.61 | 2.14 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), college completion, hdl cholesterol change with statins, hypertension (early onset hypertension), rheumatoid arthritis, variant creutzfeldt-jakob disease, years of education