rs205764 chr7:130913477 G>T
- Sequence
aatttcctcttaaaactcccttct[G/T]ttcaaaaaccctatgatccatgca
- ASB in cell types
- A549 (lung carcinoma) SK-N-SH (neuroblastoma) GM12878 (female B-cells)
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | -0.34 | 0.92 | 1.90 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, ldl cholesterol, ldl cholesterol change with statins, microalbuminuria, total cholesterol change with statins, urinary albumin-to-creatinine ratio