rs205785 chr20:57792893 T>C
- Sequence
gtgcacacctgctcctgcaattct[T/C]caagcggtgagcagctgagtgctc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.65 | -0.68 | 4.03 |
Items per page:
1 – 1 of 1