rs2058054 chr2:198296875 A>G
- Sequence
ggttcgtgctgccatctagtggtc[A/G]tattgcattatacgccgtcttcac
- ASB in cell types
- H1 (embryonic stem cells) epidermal keratinocytes erythroid progenitors
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.30 | 0.12 | 1.61 | -0.30 | Weak Concordant | |||
| RAD21_HUMAN | 2.05 | -0.10 | 1.25 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP abnormal involuntary movement scale, diastolic blood pressure (dbp), hdl cholesterol, schizophrenia