rs206084 chr13:32268036 A>G
- Sequence
ccagaggagtgcagtaccacacct[A/G]gccagcagagtgcaggtgggattc
- ASB in cell types
- HCPEpiC (choroid plexus epithelial cells) heart left ventricle MCF7 (Invasive ductal breast carcinoma) gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCPEpiC (choroid plexus epithelial cells) | 2.21 | -2.48 | 1.33 | |||
| heart left ventricle | 2.24 | -2.04 | 1.33 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.62 | 0.88 | 2.98 | |||
| gastroesophageal sphincter | 1.85 | -1.65 | 1.33 | |||
| spleen | 1.72 | -1.34 | 1.33 |
Items per page:
1 – 5 of 5