rs2062949 chr6:157622605 C>G
- Sequence
cccatggagcttgagtaaaaccac[C/G]cctgcctcccactatctctctcct
- ASB for transcription factors
- ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | n/a | 1.72 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1