rs206484 chr18:10290988 C>A
- Sequence
acagccctgtatccctaaaatgat[C/A]gtggatggagttcctctcccagcc
- ASB in cell types
- periferal blood macrophages monocyte-derived macrophages CD14+ monocytes
- ASB for transcription factors
- TF65_HUMAN SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.48 | n/a | 2.50 | n/a | No Hit | |||
| SPI1_HUMAN | 1.30 | -0.76 | 2.25 | n/a | No Hit | |||
| STAT1_HUMAN | 1.84 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, hip bone mineral density (bmd), major depressive disorder, paternal transmission distortion, stabilized warfarin dose, transmission distortion