rs2065554 chr1:56570374 T>C
- Sequence
tttgcatttctctgcaaaactctt[T/C]aggcatataattttgttaatttgt
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- IKZF2_HUMAN MTA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | -0.75 | 1.68 | 1.33 | n/a | n/a | |||
| MTA2_HUMAN | -1.93 | 1.76 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), fasting blood glucose, hdl cholesterol change with statins