rs206704 chr6:164107587 C>A
- Sequence
acagcacccaaaaacgtacacttc[C/A]gtgaactcttgcttcaacatgttt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.32 | 0.40 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, asthma, birth weight, irritible bowel syndrome, ldl cholesterol change with statins, schizophrenia, systolic blood pressure (sbp), total cholesterol change with statins