rs2071002 chr6:3000069 A>C
- Sequence
ccagtcctgcggctcctactgggg[A/C]gtgcgctggtcggaaggtgagtga
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
- ASB for transcription factors
- FOXK2_HUMAN CTCF_HUMAN ZFX_HUMAN KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 2.13 | -1.13 | 2.17 | n/a | n/a | |||
| CTCF_HUMAN | 0.61 | 0.36 | 1.20 | -1.06 | Weak Concordant | |||
| ZFX_HUMAN | 0.55 | 0.90 | 1.47 | n/a | No Hit | |||
| KDM1A_HUMAN | 2.15 | n/a | 3.00 | n/a | n/a | |||
| SMC3_HUMAN | 1.40 | -1.13 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, premature ovarian failure, spine bone mineral density (bmd), years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Kidney_Cortex, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Vagina, Whole_Blood