rs2072370 chr12:6235914 G>A
- Sequence
atgtccaactccagaatagtaaaa[G/A]gtgaccttacaaccatgtcagaaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.63 | -0.01 | 1.76 | |||
| HEK293 (embryonic kidney) | 0.52 | -0.21 | 2.01 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, amyotrophic lateral sclerosis (als) age of onset, fasting insulin, homa-ir, ldl cholesterol change with statins, obesity with early age of onset (age >2), total cholesterol change with statins